دسته‌بندی ژنتیکی ایزوله‌های اشریشیاکلی جدا شده از عفونت‌های دستگاه ادراری در استان چهارمحال و بختیاری

نوع مقاله: مقاله پژوهشی

نویسندگان

1 استاد، گروه میکروب شناسی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد

2 دانش آموخته کارشناسی ارشد میکروبیولوژی، گروه میکروب شناسی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد

3 کارشناس ارشد، گروه ژنتیک، دانشگاه شهرکرد، شهرکرد

4 کارشناس پرستاری، گروه پرستاری، دانشگاه علوم پزشکی شهرکرد، شهرکرد

چکیده

مقدمه
اشریشیاکلی‎های یوروپاتوژنیک (UPEC) یکی از شایع‎ترین عوامل میکروبی ایجادکننده عفونت‎های دستگاه ادراری می‎باشند که سروتیپ‎های مختلفی از این گروه سرمی که دارای تنوع ژنتیکی هستند در ایجاد این عفونت‎ها دخالت دارند. مطالعه حاضر با هدف دسته بندی ژنتیکی ایزوله‎های یوروپاتوژن اشریشیاکلی جدا شده از عفونت‎های دستگاه ادراری در استان چهارمحال و بختیاری انجام شد.
روش کار
تعداد 67 ایزوله UPEC که از بیماران بستری در بیمارستان‎های سطح استان چهارمحال و بختیاری جدا شده بودند، انتخاب و به روش ERIC-PCR آزمایش شدند.
نتایج
ایزوله‎های مورد مطالعه دارای الگوی باندی از محدوده 110 تا 3100 جفت باز بودند که در آنالیز الگوی باندینگ حاصله با ضریب تشابه تطابق ساده در سطح تشابه 91 درصد در 15 زیرگروه قرار گرفتند. بجز قرابت 100 درصدی که در 4 مورد دیده شد، سایر ایزوله ها دارای قرابت ژنتیکی بین 4/44 تا 1/48% بودند. قرار گرفتن ایزوله‎های مورد مطالعه در چند زیر گروه نشان گر قدرت تمایزدهی قابل قبول تکنیک ERIC-PCR در ژنوتایپینگ اشریشیاکلی و وجود منابع مختلف آلودگی دستگاه ادراری با این پاتوژن می‎باشد.
نتیجه ­گیری
روشERIC-PCR، روشی ساده، سریع و کم‌هزینه جهت توصیف تنوع ژنتیکی سویه‌های مختلف اشریشیاکلی ازجمله سویه‌هایUPEC می‌باشد.

کلیدواژه‌ها


عنوان مقاله [English]

Genotyping of Escherichia coli strains isolated from urinary tract infections in Chaharmahal and Bakhtiari province

نویسندگان [English]

  • Hassan Momtaz 1
  • GholamReza Banisharif 2
  • Fatemah Banisharif 3
  • Shokoofeh Banitalebi 4
1 Professor, Department of Microbiology, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
2 Post graduated of Microbiology, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
3 Department of Genetics, Faculty of science, Shahrekord University, Shahrekord, Iran.
4 Department of Nursing, Faculty of Nursing, Shahrekord University of Medical sciences, Shahrekord, Iran.
چکیده [English]

Background & objectives: Uropathogenic Escherichia coli (UPEC) is one of the most prevalent microbial factor resulting in urinary system infections. Many of its serotypes with genetic variety contribute to these infections. The present study was done aiming at genetic classification of UPEC strains isolated from urinary system infections in Chahrmahal & Bakhtiari province, Iran.
Materials & Methods: A total of 67 isolates of UPEC from patients hospitalized in hospitals of Chahrmahal & Bakhtiari were chosen and tested in ERIC-PCR.
Results: The studied isolates had band pattern varying from 110-3100 bp which were classified to 15 subgroups in the resulting banding pattern with simple matching similarity coefficient in 91% similarity level. Except 100 proximity found in four cases, other isolates had 44.4-48.1% genetic proximity. Placement of the studied isolates in several subgroups showed the acceptable discrimination power of ERIC-PCR technique in genotyping/ E.coli and presence of various sources of contamination of urinary system with this pathogen.
Conclusion: ERIC-PCR is a simple, fast and low cost method for describing the genetic variety of different strains of E.coli including UPEC strains.

کلیدواژه‌ها [English]

  • Uropathogenic Escherichia coli (UPEC)
  • genetic classification
  • ERIC-PCR
  • Chahrmahal & Bakhtiari province

مقدمه

 عفونت مجاری ادراری (UTI) یکی از شایع‌ترین عفونت‌های باکتریایی در انسان است که به طور عمده توسط باکتری اشریشیاکلی(ایجاد می‌شود (1). اشریشیاکلی عامل 90-80% از موارد UTI اکتسابی از جامعه و50-30% از UTI بیمارستانی می‌باشد (2). این عفونت از علل عمده بستری شدن بیماران در بیمارستان با عوارض قابل‌توجه و هزینه‌های بالای مراقبت بهداشتی است (3).

تشخیص و درمان مؤثر UTI یک نگرانی جدی در زمینه مراقبت‌های بهداشتی است (4). در سراسر جهان حدود150میلیون نفر مبتلا به UTI تشخیص داده شده که سالانه بالغ بر6 میلیارد دلار هزینه درمانی آن در جهان می باشد (5). شدت عفونت دستگاه ادراری به دو عامل بیماری‌زایی باکتری و خصوصیات میزبان بستگی دارد (1). اشریشیاکلی به عنوان یکی از مهم‌ترین عوامل ایجادکننده عفونت مجاری ادراری که به نام اشریشیاکلی یوروپاتوژنیک (UPEC) قلمداد می‌شود عوامل حدت مختلفی ازجمله آلفا همولیزین، فاکتور نکروزدهنده سایتوپاتیک، عوامل چسبندگی و سیستم‌های اکتساب آهن را دارا می‌باشد که با داشتن این عوامل منجر به آسیب بافتی می‌شود (6-8).

تحقیقات نشان داده که شیوع فاکتورهای ویرولانس در سویه‌های UPEC، با پاتوژنیسیته ادراری در ارتباط می‌باشد. به عنوان مثال دیده‌شده که همولیزین باکتری در موارد پایلونفریت،سیستیس و باکتریوری بدون علامت بیشتر تولید می‌شود (9).

اشریشیاکلی بادارابودن پادگن‌های اصلیK,H,O و نیز داشتن انواع عوامل حدت از جمله ژن fimH به روش‌های مختلف قابل تیب بندی است (10-11).

از روش‌های مختلف فنوتیپی و ژنوتیپی نظیر سروتاپینگ، بررسی الگوی پلاسمیدی، تعیین الگوی حدت و مقاومت آنتی‌بیوتیکی، روش‌های متکی بر برش آنزیمی نظیر RFLP جهت دسته‌بندی این باکتری استفاده شده است.روش‌های متکی بر PCR نظیرERIC-PCR ، RAPD-PCR ، REP-PCR و BOX-PCR به عنوان روش‌های سریع در دسته‌بندی ژنتیکی این باکتری استفاده شده‌اند. روش RAPD-PCR یکی از سریع‌ترین روش‌های تایپینگ مولکولی پیشرفته می‌باشد که به آسانی قابل انجام است. در سال‌های اخیر به دلیل سادگی این روش، سرعت بالای آن، دقت بالا، قابلیت تکرارپذیری، هزینه‌ی نسبتاً پایین و قدرت بالا در افتراق بین سویه‌ای مورد استفاده ویژه‌ای قرار گرفته است (10-11).

علاوه بر تکنیک RAPD-PCR، تکنیک ERIC-PCR جهت مطالعات اپیدمیولوژیک مورد استفاده قرار می‌گیرد. ارزیابی و سنجش‌های مبتنی بر ERIC-PCR استفاده از پرایمرهایی می‌باشد که هدف آن‌ها توالی‌های تکراری محفوظ شده در ژنوم باکتری می‌باشد. از جمله گروه‌هایی از عناصر تکراری، توالی‌های تکراری توافقی درون ژن اینتروباکتریال یا ERIC می‌باشد که در باکتری‌های روده‌ای گرم منفی شایع است.به طور کلی اجزاء و عناصر bp126، ERIC شامل یک نمونه تکراری معکوس مرکزی بسیار حفاظت‌شده در مناطق فراژنی می‌باشد که از این توالی تکراری جهت طراحی پرایمر در تکنیک ERIC-PCR جهت بدست آوردن انگشت‌نگاری DNA استفاده می‌شود (11).در مطالعه حاضر نیز از روش ERIC-PCR جهت دسته‌بندی ایزوله‌های UPEC جداشده از موارد عفونت‌های دستگاه ادراری استفاده شده است.

مواد و روش ها

در این مطالعه توصیفی-مقطعی 67 ایزوله اشریشیاکلی که از بیماران واجد عفونت‌های دستگاه ادراری از بیماران بستری در بیمارستان‌های سطح شهرستان شهرکرد در فاصله زمانی تیر ماه 1393 تا خرداد ماه 1394 جدا شده بودند، انتخاب گردید.

این ایزوله‌ها در آزمایشگاه‌های میکروب‌شناسی بیمارستان‌ها و مراکز درمانی مربوطه جدا سازی و تعیین هویت شده بودند. پس از انتقال ایزوله‌ها (رشد یافته در محیط مولر هینتون آگار) به مرکز تحقیقات میکروبیولوژی دانشگاه آزاد اسلامی واحد شهرکرد مجدداً با روش‌های متداول میکروب‌شناسی تائید هویت شدند.

جهت تائید قطعی بودن اشریشیاکلی در ایزوله‌های جداشده از روش PCR با ردیابی ژن 16srRNA استفاده شد. در این راستا از زوج پرایمرهای

  16srRNAF:        AGAGTTTGATCMTGGCTCAG ، 16srRNAR:

CCGTCAATTCATTTGAGTTT

  معرفی‌شده توسط لی و همکاران استفاده شد (12). در این مرحله از سویه استاندارد اشریشیاکلی ATCC-25922 به عنوان کنترل مثبت و از آب مقطر به عنوان نمونه کنترل منفی استفاده شد.

واکنش  PCR در حجم 25 میکرولیتر حاوی 5/2 میکرولیتر بافر x10 (PCR buffer10x )،  1 میکرولیتر Mgcl2،  5/. میکرولیتر dNTP Mix، 2/. میکرولیتر آنزیم Taq DNA Polymerase (فرمنتاس ـ لیتوانی)، 1 میکرولیتر از هریک از پرایمرهای ذکر شده در بالا ، 2 میکرولیتر از DNA مربوط به هر یک از ایزوله ها و 8/16 میکرولیتر آب مقطر  تنظیم شد. برنامه حرارتی و زمانی واکنش PCR به صورت مراحل پیش رو انجام پذیرفت :

واسرشته سازی اولیه یک چرخه  5 دقیقه ای در دمای 94 درجه سانتیگراد، و در ادامه 33 چرخه شامل  واسرشته شدن در دمای 94 درجه سانتیگراد به مدت 60 ثانیه ، اتصال آغازگرها در دمای 58 درجه سانتیگراد به مدت 45 ثانیه، بسط در دمای 72 درجه سانتیگراد به مدت 60 ثانیه و در نهایت گسترش نهایی در دمای 72 درجه سانتیگراد به مدت 7 دقیقه.

 در انتها محصول PCR  در این مرحله بر روی ژل آگارز 1 درصد الکتروفورز شد و از ژل حاصله در حضور نور UV تصویربرداری و ثبت شد.

به منظور دسته‌بندی ژنتیکی ایزوله‌های اشریشیاکلی مورد مطالعه از روش Enterobacterial  repetitive intergenic consensus PCR (ERIC-PCR)  طبق روش توصیه شده توسط Versalovic و همکاران استفاده شد (13).

در این روش، PCR در واکنشی به حجم 50 میکرولیتر شامل 5 میکرولیتر PCR buffer10x ،  4 میکرولیتر Mgcl2،  75/1 میکرولیتر dNTP Mix، 6/. میکرولیتر آنزیم Taq DNA Polymerase، 3 میکرولیتر از زوج پرایمرهای

 ERIC1: ATGTAAGCTCCTGGGGATTCAC  ERIC2: AAGTAAGTGACTGGGGTGAGCG

 3 میکرولیتر از DNA مربوط به هر یک از ایزوله ها و 65/29 میکرولیتر آب مقطر انجام گرفت. برنامه حرارتی مورد استفاده در تکنیکERIC-PCR جهت دسته‌بندی ژنتیکی ایزوله‌های جداشده به شرح زیر تنظیم گردید:

واسرشته سازی اولیه یک چرخه  6 دقیقه ای در دمای 94 درجه سانتیگراد، و در ادامه 30 چرخه شامل  واسرشته شدن در دمای 94 درجه سانتیگراد به مدت 30 ثانیه ، اتصال آغازگرها در دمای 52 درجه سانتیگراد به مدت 35 ثانیه، بسط در دمای 72 درجه سانتیگراد به مدت 4 دقیقه  و گسترش نهایی در دمای 72 درجه سانتیگراد به مدت 5 دقیقه.

محصولPCR  مربوط به مرحله فوق روی ژل آگارز 2 درصد الکتروفورز شد و از ژل حاصله در حضور نور UV تصویربرداری و ثبت شد.

آزمایش ERIC-PCR روی هرکدام از ایزوله‌های مورد مطالعه 3 نوبت انجام گرفت تا از تعداد باندهای ایجادشده توسط هرایزوله اطمینان حاصل گردد.  جهت ترسیم درخت فیلوژنتیکی و  آنالیز  تصاویر حاصل از الکتروفورز نمونه‌های مورد مطالعه،از نرم‌افزار(NTSYS version2.02e) استفاده گردید. برای این منظور ابتدا باندهای حاصل از الکتروفورز محصول نشانگر، به صورت داده‌های کمی صفر و یک (وجود باند یا عدم وجود باند)،  امتیازدهی شدند. پس از امتیازدهی ژل‌ها، شباهت ژنتیکی بر اساس داده‌های صفر و یک با استفاده از ضریب جاکارد و دایس و تطابق ساده محاسبه شد. به منظور تعیین کارایی روشERIC تجزیه خوشه‌ای بر مبنای ضرایب تشابه، از ضریب همبستگی کوفنتیک استفاده گردید. سپس برای گروه‌بندی سویه‌ها، تجزیه خوشه‌ای به روش (Unweighted Pair Group Method using arithmetic Averages) UPGMA  بر مبنای ضریب تشابهی که بالاترین ضریب همبستگی کوفنتیک را دارا بود، استفاده گردید.

نتایج

علاوه بر آزمون‎های میکروبی متداول  به منظور تشخیص ایزوله‎های اشریشیاکلی  از روش PCR جهت ردیابی ژن 16srRNA استفاده گردید؛  نتیجه حاصل از ردیابی  ژن 16srRNA  در شکل 1  که حاصل از الکتروفورز محصول PCR  این ژن می‎باشد، نشان داده شده است.  حضور قطعه 919 جفت بازی تائید گر این مطلب است.

PCR عناصر تکرارشونده ERIC  یکی از روش‎های سریع و ساده‎ای است که به طورمعمول در شناسایی، طبقه بندی و بررسی تنوع عوامل باکتریایی بکار می رود (15-13) . توالی‎های تکراری ERIC از  جمله توالی‎هایی هستند که در سرتاسر ژنوم باکتری‎های بیماری‎زا پراکنده هستند و ممکن است نقش مهمی در سازماندهی ژنوم باکتری‎ها داشته باشند.  با ردیابی پراکنش این توالی‎ها در ژنوم باکتری‎ها با استفاده از روش ذکر شده می‎توان به ساختار و مسیر تکاملی ژنوم آن ها دست یافت (16).

در این بررسی جهت دسته بندی ژنتیکی ایزوله‎ها از روش ERIC-PCRاستفاده شد که در این راستا 67 ایزوله مورد مطالعه سه نوبت با روش ERIC-PCR آزمایش و پس از اطمینان از حضور قطعات تکثیر یافته در PCR (تصاویر 2تا 5) آنالیز شدند.

طبق تصاویر (2تا5) ایزوله‌های مورد مطالعه دارای الگوی باندی از محدود 110تا 3100 جفت بازی DNA بودند که قطعات تکثیر یافته در ایزوله‌ها در قالب اعداد 1(وجود باند) و 0 (عدم وجود باند) امتیازدهی و به‌وسیله بازخوانی مقادیر کامپیوتری ژل‌هادر برنامه NTSYSآنالیز شدند. پس از امتیازدهی ژل‌ها،شباهت ژنتیکی بر اساس داده‌های 0 و 1 با استفاده از ضرایب جاکارد،دایس و تطابق ساده محاسبه شدکه ضریب کوفنتیک محاسبه‌شده برای الگوریتم UPGMA و هر کدام از سه ضریب فوق در جدول 1 آورده شده است.

طبق اطلاعات جدول فوق ضریب تطابق ساده (692/0) بزرگ‌تر از دو ضریب جاکارد و دایس بوده لذا جهت محاسبه درصد تشابه ژنتیکی ایزوله‌ها و ترسیم درخت فیلوژنی از این ضریب استفاده شد.

در نشانگر ERIC-PCR در چهار مورد، ایزوله‌ها دارای قرابت 100% (ضریب شباهت1) بودند. قرابت ژنتیکی 100% بین ایزوله‌های شماره 2و 3 ایزوله‌های 17و 18، ایزوله‌های 42و 48 و ایزوله‌های 53و 54 مشاهده شد.

کمترین قرابت ژنتیکی بین دوایزوله 24 و 44(ضریب شباهت 444/0)، ایزوله‌های 20 با 23،  24 با 34، 24 با 38 و 24 با 47 (ضریب شباهت 481/0) مشاهده شد.

به‌جز قرابت 100 درصدی که بین ایزوله‌های فوق‌الذکر مشاهده شد. بین سایر ایزوله‌های مورد مطالعه بیشترین شباهت ژنتیکی 2/96 درصد بود که بین ایزوله‌های 42با43 ، 42 با 49 ، 43 با 48 ، 48 با 49 ، 52 با 39 ، 52 با 45 ، 52 با67 ، 64 با 58 ، 64 با 59 دیده شد.

در دندروگرام حاصل از نشانگرERIC-PCR ، مجموع 67 ایزوله مورد مطالعه در سطح تشابه 63 درصد در دو گروه Aو B قرار می‌گیرند. که گروه A دارای دو زیرگروه وکه هرکدام دارای یک ایزوله (ایزوله‌های 24و 1) و گروه B دارای دو زیر گروهو که دارای دو زیرشاخهکه زیرشاخه  تنها دارای یک ایزوله (ایزوله 20) و زیرشاخهبا دو زیرگروه  و   با تعداد زیادی زیرشاخه و زیرگروه دارای دو شاخه و با یک ایزوله در هر شاخه (ایزوله‌های 30 و 33) هستند (تصویر6).

تصویر6- دندروگرام حاصل از آنالیز ایزوله‌های یوروپاتوژنیک اشریشیاکلی با نشانگرERIC-PCRبر مبنای ضریب تطابق ساده

در سطح تشابه 72% ایزوله‌های مورد مطالعه دارای 9 زیرگروه، در سطح تشابه 81% دارای 23 زیرگروه بوده که تعداد زیرگروه‌ها در سطح تشابه 91% به 51 زیرگروه افزایش می‌یابند که خود نشانگر تنوع ژنتیکی بالا در بین ایزوله‌های مورد مطالعه است.

بحث

باکتری اشریشیاکلی یکی از شایع‌ترین عوامل میکروبی دخیل در ایجاد عفونت‌های دستگاه ادراری است که سروتیپ‌های مختلفی از این باکتری که اشریشیاکلی یوروپاتوژنیک گفته می‌شوند، در ایجاد این عفونت‌ها دخیل می‌باشد (17).

درگذشته از روش‌های فنوتیپی ازجمله سروتایپینگ جهت دسته‌بندی سویه‌های این باکتری استفاده می‌شد. امروزه روش‌های مولکولی جایگزین روش‌های مرسوم فنوتیپی شده است. چند روش برای دسته‌بندی سویه‌های مختلف اشریشیاکلی طراحی و ارائه‌ شده است. ارزیابی سیستم‌های مختلف طبقه‌بندی باکتری‌ها در بررسی‌های اپیدمیولوژیکی بر پایه معیارهای مهمی نظیر توان تمایزدهی تکنیک، قابلیت تعیین تیپ و تکرارپذیری روش مربوطه می‌باشد. روش‌های مختلف فنوتیپی و ژنوتیپی برای تیپ‌بندی سویه‌های اشریشیاکلی شناخته شده است(18). روش‌های فنوتیپی نظیر سروتایپینگ و فاژتایپینگ قدرت تمایزدهی پایینی دارند از این‌رو روش‌های ژنوتیپی با قدرت تمایز بالا، هزینه پایین، کاربرد آسان و سریع در شناسایی و دسته‌بندی سویه‌های اشریشیاکلی کاربرد پیدا کرده‌اند (19).

اخیراًروش‌های مختلفی برای تعیین منشأ و منبع میکروب‌ها به‌کاررفته‌اند. روش‌هایی مثل ریبوتایپینگ،ERIC-PCR، RAPD-PCR و RFLP به طرز موفقیت‌آمیزی برای متمایز کردن سویه‌های باکتری‌های مختلف استفاده شده‌اند (23-20).

ازکاربردی‌ترین روش‌ها در تیپ‌بندی سویه‌های اشریشیاکلی روش‌های مبتنی بر PCR به‌ویژه سه روش RAPD-PCR،ERIC-PCR و RFLP-PCR می‌باشد، در این مطالعه نیز از روش ERIC-PCRجهت دسته‌بندی ایزوله‌های یوروپاتوژنیک اشریشیاکلی جداشده از عفونت‌های دستگاه ادراری در بیماران بستری در بیمارستان‌های استان چهارمحال و بختیاری استفاده شد.

67 ایزوله اشریشیاکلی یوروپاتوژنیک با نشانگرERIC-PCR، آزمایش و میزان شباهت ژنتیکی آن‌ها با ضریب تطابق ساده تعیین گردید. به‌جزشباهت 100 درصدی که در چهار مورد بین ایزوله‌هایی 2با 3،17با 18، 42 با 48و 53 با54 مشاهده شد، بیشترین و کمترین درصد قرابت از 4/44 تا 2/96%  بین ایزوله‌های موردمطالعه دیده شد و همان‌گونه که در درخت فیلوژنی ترسیم‌شده بر اساس ضریب تطابق ساده، مشهود است، ایزوله‌هایUPEC مورد بررسی در سطح تشابه 63% در دو گروه Aو B با دو زیرگروهA1 و A2، B1 و B2 قرار گرفتند درحالی‌که در سطح تشابه 72%، در 9 زیرگروه، در سطح تشابه 81% در 23 زیرگروه و در سطح تشابه 91% در 51 زیرگروه قرار گرفتند که خود نشانگر تنوع بالای ژنتیکی بین ایزوله‌های مورد مطالعه می‌باشد ونشان می دهد که منابع مختلفی می توانند منشاءآلودگی دستگاه ادراری به اشریشیاکلی باشند.

در سال 2002، da Silveira و همکاران 49 ایزوله اشریشیاکلی از مرغان مبتلابه سپتی‌سمی، سندرم تورم سر و مرغ‌های بدون علائم کلینیکی، جداسازی و از روشERIC-PCR برای دسته‌بندی آن‌ها استفاده کردند. ایزوله‌ها در چهار گروه A تا D قرار گرفتند و نتایج نشان داد که روش ERIC-PCR می‌تواند جایگزین مناسبی برای روش‌های مولکولی مثل  RAPD-PCRو RFLP-PCR باشد (24).

Meacham و همکاران در دانشگاه میشیگان، تعداد زیادی از ایزوله‌های اشریشیاکلی را ژنوتایپینگ کرده و نتیجه گرفتند که بیش از یک روش ERIC-PCR را باید جهت دسته‌بندی ژنتیکی این باکتری استفاده کرد (25).

در مطالعه Ranjbar و Ardakani از روش ERIC-PCR جهت ژنوتایپینگ 98 ایزوله اشریشیاکلی که در  فاصله ژوئن 2014 تا ژانویه 2015 از بیمارستان بقیه‌الله تهران جداشده بودند استفاده کردند. در این بررسی ایزوله‌ها در سطح تشابه 70 درصد در 6 زیرگروه E1 تا E6 قرار گرفتند(26). در سال 2006، Wilson و همکاران، انتشار توالی‌های ERICرا درکل ژنوم باکتری‌های روده‌ای از جمله اشریشیاکلی و شیگلا بررسی کردند و مشاهده کردند که توالی‌هایERIC در ناحیه نزدیک ژن‌هایی با بیان بالا، بیشتر یافت می‌شوند و چون این توالی‌ها کوچک هستند، تکنیک ERIC-PCR کاربرد گسترده‌ای در ژنوتایپینگ ایزوله‌های باکتریایی دارد (27).  Ramezanzadeh و همکاران از روش ERIC برای ارزیابی تنوع ژنتیکی 230 ایزوله اشریشیاکلی جداشده از عفونت‌های بیمارستانی استفاده کردند و دریافتند که 205 ایزوله از این نمونه‌ها را می‌توان در 20 ژنوتیپ جداگانه قرار داد که اغلب آن‌ها در گروه فیلوژنتیکی D قرار می‌گیرند (28).

Lang و همکاران در مطالعه‌ای روی ایزوله‌های انتروتوکسیژنیک اشریشیاکلی جداشده از گاو نشان دادند که روش ERIC-PCR یک روش کاربردی و سریع در طبقه‌بندی فیلوژنتیکی و بررسی ساختار تکامل نژادی سویه‌های اشریشیاکلی می‌باشد (29).

نتیجه گیری

انتخاب یک تکنیک ژنوتایپینگ به سطح مهارت کاربران و امکانات آزمایشگاه و نیز به هدف بررسی وابسته است. در بررسی حاضر از تکنیک ERIC-PCRجهت دسته‌بندی ژنتیکی سویه‌هایUPECبه‌عنوان یکی از مهم‌ترین و شایع‌ترین میکروارگانیسم‌های یوروپاتوژن استفاده شد و قرار گرفتن ایزوله‌های موردمطالعه در چندین زیرگروه نشانگر قدرت تمایزدهی قابل‌قبول این تکنیک در ژنوتایپینگ اشریشیاکلی می‌باشد. درمجموع نتایج تحقیق حاضر نشان داد که روشERIC-PCR، روشی ساده، سریع و کم‌هزینه جهت توصیف تنوع ژنتیکی سویه‌های مختلف اشریشیاکلی ازجمله سویه‌هایUPEC می‌باشد اما توصیه می‌گردد که مطالعات بیشتری روی نمونه‌های اخذشده از بیمارستان‌های مختلف سطح کشور انجام و روش ERIC-PCR با روش‌های مولکولی نوین‌تر مثلPFGE مقایسه گردد امید است که نتایج مطالعه حاضر در بررسی اپیدمیولوژی مولکولی سویه‌های یوروپاتوژنیک اشریشیاکلی و ارتقای سلامت عمومی جامعه استان چهارمحال و بختیاری مفید باشد.

1. Adibfar P. Medical microbiology for undergraduate medical students, paramedical and specialized fields. 1st ed. Tehran, Iran. Noor-e Danesh Publisher; 2000. P. 85-100. (Persian) 2. Emtiazi G, Karimi M. The basics of biomolecular and genetic engineering. 1st ed. Tehran, Iran: Mani Publisher; 2005. P. 5-10. (Persian)
3. James MJ. Microbiology of modern food. Trans: Ashraf M, Motamedzadegan A, Alami A, Gohari Ardabili M. 6th ed. Mashhad, Iran: Ferdowsi University Publisher; 2003. P. 455-75. (Persian) 4. Tabatabaei A, Firoozi R. Animal bacterial disease. Tehran, Iran: Tehran University Publisher; 2005. P. 206-28. (Persian) 5. Haghighi L. Intestinal bacteria (Enterobacteriaceae family). 1st ed. Bushehr, Iran: Bushehr’s Medical Science University; 2004. P. 1113-59. (Persian)
6. Razavilar V. Pathogenic microbes in food and epidemiology of food poisoning. Tehran, Iran: Tehran University Publisher; 2002. P. 84-90. (Persian) 7. Rokni N. Health principles of food. Tehran, Iran: Tehran University Publisher; 2002. P. 64-100. (Persian)
8. Zaeem Kohan J. Harrison’s infectious diseases. Principles of Harrison’s internal medicine. 1st ed. Tehran, Iran: Lamat Publication; 2001. P. 373-81. (Persian)
9. Zamanzad B. Determine the most common bacterial causes of urinary tract infection in women (at the age of sexual activity) and investigating their susceptibility pattern to conventional antibiotics in the referrals to the laboratory of specialized clinics of Shahrekord University of Medical Sciences. Traditional Med 1996; 1:21-5. (Persian) 10. Shah-Hosseini M, Rezaei Tehrani H. Polymerase chain reaction (PCR). 1st ed. Tehran, Iran: Basiran Publisher; 2001. P. 8-30. (Persian)
11. Freezer V, Vostaff D. Food microbiology. Trans: Ghasemia Safaei H. Isfahan, Iran: Isfahan University of Medical Sciences; 2004. P. 505-6. (Persian)
12. Li D, Liu B, Chen M, Guo D, Guo X, Liu F, et al. A multiplex PCR method to detect 14 Escherichia coli serogroups associated with urinary tract infections. J Microbiol Methods 2010; 82:71-7.
13. Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 1991; 19:6823-31.
14. Vicente JG, Roberts SJ. Discrimination of Pseudomonas syringae isolates from sweet and wild cherry using rep-PCR. Eur J Plant Pathol 2007; 117:383-92.
15. Ménard M, Sutra L, Luisetti J, Prunier JP, Gardan L. Pseudomonas syringae pv. avii (pv. nov.), the causal agent of bacterial canker of wild cherries (Prunus avium) in France. Eur J Plant Pathol 2003; 109:565-76.
16. Louws FJ, Fulbright DW, Stephens CT, de Bruijn FJ. Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Appl Environ Microbiol 1994; 60:2286-95.
17. Momtaz H, Karimian A, Madani M, Safarpoor Dehkordi F, Ranjbar R, Sarshar M, et al. Uropathogenic Escherichia coli in Iran: serogroup distributions, virulence factors and antimicrobial resistance properties. Ann Clin Microbiol Antimicrob 2013; 12:8.
18. Tenover FC, Arbeit RD, Goering RV. How to select and interpret molecular strain typing methods for epidemiological studies of bacterial infections: a review for healthcare epidemiologists. Infect Control Hosp Epidemiol 1997; 18:426-39.

19. Rostamzad A, Esfahani SH, Enteshari J. The investigation of molecular epidemiology of Shigella soneii isolated from clinical cases in Tehran using RAPD-PCR method. Sci Med J 2010; 9:279-89.
20. Rodtong S, Tannock GW. Differentiation of Lactobacillus strains by ribotyping. Appl Environ Microbiol 1993; 59:3480-4.
21. Parabhu V, Isloor S, Balu M, Suryanarayana VV, Rathnamma D. Genotyping by ERIC-PCR of Escherichia coli isolated from bovine mastitis cases. Indian J Biotechnol 2010; 9:298-301.
22. Gomes AR, Muniyappa L, Krishnappa G, Suryanarayana VV, Isioor S, Prakash B, et al. Genotypic characterization of avian Escherichia coli by random amplification of polymorphic DNA. Int J Poult Sci 2005; 4:378-81.
23. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 1997; 35:907-14.
24. da Silveira WD, Ferreira A, Lancellotti M, Barbosa IA, Leite DS, de Castro AF, et al. Clonal relationships among avian Escherichia coli isolates determined by enterobacterial repetitive intergenic consensus (ERIC)-PCR. Vet Microbiol 2002; 89:323-8.
25. Meacham KJ, Zhang L, Foxman B, Bauer RJ, Marrs CF. Evaluation of genotyping large numbers of Escherichia coli isolates by enterobacterial repetitive intergenic consensus-PCR. J Clin Microbiol 2003; 41:5224-6. 26. Ardakani MA, Ranjbar R. Molecular typing of uropathogenic E. Coli strains by the ERIC-PCR method. Electron Physician 2016; 8:2291-6. 27. Wilson LA, Sharp PM. Enterobacterial repetitive intergenic consensus (ERIC) sequences in Escherichia coli: Evolutionand implications for ERIC-PCR. Mol Biol Evol 2006; 23:1156-68.
28. Ramazanzadeh R, Zamani S, Zamani S. Genetic diversity in clinical isolates of Escherichia coli by enterobacterial repetitive intergenic consensus (ERIC)–PCR technique in Sanandaj hospitals. Iran J Microbiol 2013; 5:126-31.
29. Xiu-Yan LA, Zhang YL, Jiang HT, Jiao LI, Hong-Bo NI. Development of an enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) to detect and genotype enterotoxigenic Escherichia coli of calf origin. Afr J Microbiol Res 2013; 7:4001-5.